pgsk (Santa Cruz Biotechnology)
Santa Cruz Biotechnology is a verified supplier 
96
Structured Review
Santa Cruz Biotechnology
pgsk
Pgsk, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 303 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgsk+3%CE%B2/p-GSK-3%CE%B2+Antibody/pmc12362930-65-56-57
Average 96 stars, based on 303 article reviews
Pgsk, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 303 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgsk+3%CE%B2/p-GSK-3%CE%B2+Antibody/pmc12362930-65-56-57
Average 96 stars, based on 303 article reviews
pgsk - by Bioz Stars,
2026-09
96/100 stars
Images
1) Product Images from "The dual GLP-1 and GIP receptor agonist tirzapetide provides an unintended interaction with the β-adrenoceptors and plays a role in glucose metabolism in hyperglycemic or senescent cardiac cells"
Article Title: The dual GLP-1 and GIP receptor agonist tirzapetide provides an unintended interaction with the β-adrenoceptors and plays a role in glucose metabolism in hyperglycemic or senescent cardiac cells
Journal: Cardiovascular Diabetology
doi: 10.1186/s12933-025-02828-z
Figure Legend Snippet: Effect of the TZPD application on the cellular resting level of Ca 2+ and protein levels of parameters played roles in cellular Ca 2+ regulation via β-AR signaling. The cellular resting level of Ca 2+ was imagined in all groups of H9c2 cells loaded with a Ca 2+ -sensitive fluorescence dye Fluo-3 AM ( A ). The representative flow cytometry data demonstrate the effect of TZPD (40 nM) on intracellular Ca 2+ distribution in resting cells with and without receptor antagonism for the SC group of cells and HG group of cells (left). The average cellular Ca 2+ level in Fluo-3 AM loaded H9c2 cells was measured in all groups by the flow cytometer technique (right). The protein levels of phosphorylated PKA (pPKA) and PKA and their ratios ( B ), and phosphorylated GSK (pGSK) and GSK and their ratios ( C ), compared to a reference protein GAPDH in the SC, SC + TZPD, SC + TZPD + ANT or HG, HG + TZPD, HG + TZPD + ANT comparison to the NC group. All shortenings are the same as given in previous figures. Representative protein bands are given in the left parts of the bar graphs. Data are presented as means ± SEM. The comparisons between the two groups are performed by t-test. * p < 0.05 vs. NC group, γ p < 0.05 vs. SC group, δ p < 0.05 vs. HG group, Ψ p < 0.05 vs. SC + ANT + TZPD group, τ p < 0.05 vs. HG + ANT + TZPD group ( n = 4 for flow cytometry experiments and n = 3 for western blotting experiments)
Techniques Used: Fluorescence, Flow Cytometry, Comparison, Western Blot
Related Articles
Incubation:Article Title: Targeting early tau pathology: probiotic diet enhances cognitive function and reduces inflammation in a preclinical Alzheimer’s model Article Snippet: .. They were then incubated for 2 h at room temperature with the following antibodies: pTau S262 (AB92627, Abcam, 1:2000), pTau S356 (AB75603, Abcam, 1:5000), Article Title: Extracellular 5'-nucleotidase (CD73) promotes human breast cancer cells growth through AKT/GSK-3β/β-catenin/cyclinD1 signaling pathway. Article Snippet: .. 6 / 13 GGTGGCTTTTAGGATGGCAAG, β-actin reverse primer: ACTGGAACGGTGAAGGTG ACAG; CD73 forward primer: ATTGCAAAGTGGTTCAAAGTCA, CD73 reverse primer: ACACTTGGCCAGTAAAATAGGG; Primary antibodies against β-actin (KangWei Century, China), CD73, AKT, P-AKT, GSK-3β, Article Title: miR-221 regulates proliferation, invasion, apoptosis and progression of prostate cancer cells by modulating E-cadherin/Wnt/β catenin axis Article Snippet: .. The membrane was then incubated with primary antibodies against Cyclin D1 (BD Biosciences, Cat.#556470, 1:500 dilution), β-catenin (Santa Cruz Biotechnologies, Cat.#sc-7963, 1:200 dilution), GSK-3β (BD Biosciences, Cat.#610202, 1:2500 dilution), Article Title: Targeting early tau pathology: probiotic diet enhances cognitive function and reduces inflammation in a preclinical Alzheimer's model. Article Snippet: .. They were then incubated for 2 h at room temperature with the following antibodies: pTau S262 (AB92627, Abcam, 1:2000), pTau S356 (AB75603, Abcam, 1:5000), Membrane:Article Title: miR-221 regulates proliferation, invasion, apoptosis and progression of prostate cancer cells by modulating E-cadherin/Wnt/β catenin axis Article Snippet: .. The membrane was then incubated with primary antibodies against Cyclin D1 (BD Biosciences, Cat.#556470, 1:500 dilution), β-catenin (Santa Cruz Biotechnologies, Cat.#sc-7963, 1:200 dilution), GSK-3β (BD Biosciences, Cat.#610202, 1:2500 dilution), Control:Article Title: miR-221 regulates proliferation, invasion, apoptosis and progression of prostate cancer cells by modulating E-cadherin/Wnt/β catenin axis Article Snippet: .. The membrane was then incubated with primary antibodies against Cyclin D1 (BD Biosciences, Cat.#556470, 1:500 dilution), β-catenin (Santa Cruz Biotechnologies, Cat.#sc-7963, 1:200 dilution), GSK-3β (BD Biosciences, Cat.#610202, 1:2500 dilution), Immunodetection:Article Title: Copaiba Oil Attenuates Right Ventricular Remodeling by Decreasing Myocardial Apoptotic Signaling in Monocrotaline-Induced Rats Article Snippet: Proteins were electrotransferred onto polyvinylidene fluoride (PVDF) membranes (Immuno-Blot 0.2 μm, BioRad). .. The membranes were processed for immunodetection using the following antibodies: eNOS, pAkt, Akt, pJNK, JNK, other:Article Title: p110α and p110β isoforms of PI3K are involved in protection against H 2 O 2 induced oxidative stress in cancer cells. Article Snippet: Purpose Phosphatidylinositol-3 kinases (PI3Ks) are involved in regulating cell growth, proliferation, differentiation, apoptosis and survival. p110α and p110β, two ubiquitously expressed isoforms of PI3K signalling, are involved in growth factor mediated signaling and survival by generating second messengers.. Earlier, we have generated GFP-fusion proteins of p110α and p110β and expressed them in normal and cancer cell-lines to investigate their subcellular localization and their role in various activities.. Here, we sought to examine the role of p110α and p110β isoforms in protecting MCF-7 breast cancer cells against oxidative stress. Chromatin Immunoprecipitation:Article Title: A dysfunctional TRPV4-GSK3β pathway prevents osteoarthritic chondrocytes from sensing changes in extracellular matrix viscoelasticity. Article Snippet: 1Department of Orthopaedic Surgery, Stanford University School of Medicine, Stanford, CA, USA.. 2Department of Mechanical Engineering, Stanford University, Stanford, CA, USA.. 3These authors contributed equally: Pranay Agarwal, Hong-pyo Lee. Flow Cytometry:Article Title: A dysfunctional TRPV4-GSK3β pathway prevents osteoarthritic chondrocytes from sensing changes in extracellular matrix viscoelasticity. Article Snippet: 1Department of Orthopaedic Surgery, Stanford University School of Medicine, Stanford, CA, USA.. 2Department of Mechanical Engineering, Stanford University, Stanford, CA, USA.. 3These authors contributed equally: Pranay Agarwal, Hong-pyo Lee. Magnetic Resonance Imaging:Article Title: A dysfunctional TRPV4-GSK3β pathway prevents osteoarthritic chondrocytes from sensing changes in extracellular matrix viscoelasticity. Article Snippet: 1Department of Orthopaedic Surgery, Stanford University School of Medicine, Stanford, CA, USA.. 2Department of Mechanical Engineering, Stanford University, Stanford, CA, USA.. 3These authors contributed equally: Pranay Agarwal, Hong-pyo Lee. |